SubtiBank SubtiBank
rsbU
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rsbU

protein serine phosphatase, environmental PP2C, dephosphorylates [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV]
locus
BSU_04700
pI
4.91
mw
38.48 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
function
control of [protein|search|SigB ]activity
product
protein serine phosphatase, environmental PP2C
essential
no
ec
3.1.3.3
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • Gene

    Coordinates
    521,019 522,026

    The protein

    Catalyzed reaction/ biological activity

  • O-phospho-L(or D)-serine + H2O --> L(or D)-serine + phosphate (according to UniProt)
  • [SW|Domains]

  • [SW|PPM-type phosphatase domain] (aa 123-333) (according to UniProt)
  • Structure

  • [PDB|2J6Y]
  • Expression and Regulation

    Operons

    genes
    [gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
    description
    [Pubmed|8002610]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE04700 ([gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTAAAATCCACGTTCTTAC, downstream forward: _UP4_TAACGTCTGTCAGACGAGGG
  • BKK04700 ([gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTAAAATCCACGTTCTTAC, downstream forward: _UP4_TAACGTCTGTCAGACGAGGG
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • [SW|Rick Lewis], Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/r.lewis homepage]
  • References

    Reviews

  • 20658979,33042030
  • Original publications

  • 27977677,10632888,8002610,28461450