SubtiBank SubtiBank
pcrB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pcrB

heptaprenylglyceryl phosphate synthase
locus
BSU_06600
pI
4.20
mw
24.94 kDa
protein length
228 aa Sequence Blast
gene length
687 bp Sequence Blast
function
unknown
product
heptaprenylglyceryl phosphate synthase
essential
no
synonyms
yerE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • Gene

    Coordinates
    718,622 719,308

    The protein

    Catalyzed reaction/ biological activity

  • production of heptaprenylglyceryl phosphate from heptaprenyl diphosphate and glycerol-1-phosphate [Pubmed|23322418]
  • all-trans-heptaprenyl diphosphate + sn-glycerol 1-phosphate --> 3-heptaprenyl-sn-glycero-1-phosphate + diphosphate (according to UniProt)
  • Protein family

  • GGGP/HepGP synthase family (single member, according to UniProt)
  • Structure

  • [PDB|1VIZ] [Pubmed|23322418]
  • Expression and Regulation

    Operons

    genes
    [gene|0BA7EC658F5C2397A90B68AC234D04966966561C|pcrB]-[gene|C73E52D214E24F21696973B19B0A44CE785D6FBA|pcrA]-[gene|03EFF93C1B0CE075AE068ECC4EDE9BE5D03C857E|ligA]-[gene|ADAE6B5C301959D90592A6F26DFE1690BF6F5552|yerH]
    description
    [Pubmed|9701819]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A926 (yerE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/926 NBRP B. subtilis, Japan]
  • BKE06600 ([gene|0BA7EC658F5C2397A90B68AC234D04966966561C|pcrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCATACGTTCCTCCAT, downstream forward: _UP4_TAGTAAATTGTACGGATTTG
  • BKK06600 ([gene|0BA7EC658F5C2397A90B68AC234D04966966561C|pcrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCATACGTTCCTCCAT, downstream forward: _UP4_TAGTAAATTGTACGGATTTG
  • References

  • 9701819,22614947,21761520,18558723,23322418,24684232