SubtiBank SubtiBank
nupP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nupP

[SW|ABC transporter] for guanosine (membrane protein)
locus
BSU_31560
pI
9.39
mw
36.69 kDa
protein length
348 aa Sequence Blast
gene length
1047 bp Sequence Blast
function
uptake of guanosine
product
[SW|ABC transporter] for guanosine
essential
no
synonyms
yufP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,242,610 3,243,656

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN]-[gene|71546D1508EF17A208332E162CAE2C299987A569|nupO]-[gene|0BB235F189D30C9BE798560C31DA59FF0112CFD9|nupP]-[gene|7A80910F4E62BA15DE93FFC70E1908FB5CB9542D|nupQ]
    description
    [Pubmed|21926227]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21926227], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455,21699902,21926227], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455,21699902,21926227]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B555 (yufP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1554 NBRP B. subtilis, Japan]
  • BKE31560 ([gene|0BB235F189D30C9BE798560C31DA59FF0112CFD9|nupP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTAACCATTTGCTTTCCC, downstream forward: _UP4_TTGAAGAAAAAGGGGGCGAA
  • BKK31560 ([gene|0BB235F189D30C9BE798560C31DA59FF0112CFD9|nupP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTAACCATTTGCTTTCCC, downstream forward: _UP4_TTGAAGAAAAAGGGGGCGAA
  • References

  • 10092453,21926227,12618455