SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cofactor of the [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX] complex
16.88 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
control of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] activity in peptidoglycan elongation
cofactor of the [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX] complex

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,576,717 2,577,181

    Phenotypes of a mutant

  • synthetic lethal with [protein|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|LytE], this can be suppressed by point mutations in [gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE] or [gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX] [pubmed|31437162]
  • cells are shorter and fatter than wild-type, cells are bent and curved, both phenotypes depend on the presence of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] [pubmed|31437162]
  • The protein


  • cell membrane (integral), C-terminal cytoplasmic domain [pubmed|31437162]
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • MGNA-C484 (yqzC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24940 ([gene|0BC657B63EE124B17FDA7914262E706B2CC9ABC1|sweC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATGCCTGAATGCCCCGTT, downstream forward: _UP4_TAAAAAAACAGGCTGACTCA
  • BKK24940 ([gene|0BC657B63EE124B17FDA7914262E706B2CC9ABC1|sweC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATGCCTGAATGCCCCGTT, downstream forward: _UP4_TAAAAAAACAGGCTGACTCA
  • References

  • 14651647,31437162