SubtiBank SubtiBank
yonC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yonC

unknown
locus
BSU_21140
pI
5.43
mw
19.46 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,235,694 2,236,230

    Biological materials

    Mutant

  • BKE21140 ([gene|0C0729B381ED7A2144D6777CA88EF512C7E7367B|yonC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTATTCCTCCAAGT, downstream forward: _UP4_TAATACATAACAAATAAATT
  • BKK21140 ([gene|0C0729B381ED7A2144D6777CA88EF512C7E7367B|yonC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTATTCCTCCAAGT, downstream forward: _UP4_TAATACATAACAAATAAATT