SubtiBank SubtiBank
yvcI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvcI

[SW|Nudix hydrolase]
locus
BSU_34780
pI
4.99
mw
18.07 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    3,572,413 3,572,889

    The protein

    Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • Structure

  • [PDB|3FK9] (the protein from ''B. halodurans'', 59% identity/ 82% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|yvcI]-[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]-[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]-[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA]-[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]-[gene|C521BEE1EEEA7AD283A3C47C34301A8603CD9188|yvcN]
    description
    [Pubmed|9237995]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B642 (yvcI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1641 NBRP B. subtilis, Japan]
  • BKE34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|yvcI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC, downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
  • BKK34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|yvcI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC, downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12850135,9237995,16272399,20525796