SubtiBank SubtiBank
fruC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fruC

fructokinase
locus
BSU_06170
pI
4.62
mw
34.10 kDa
protein length
320 aa Sequence Blast
gene length
963 bp Sequence Blast
function
utilization of sucrose and glucitol
product
fructokinase
essential
no
synonyms
ydjE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • Gene

    Coordinates
    670,087 671,049

    The protein

    Catalyzed reaction/ biological activity

  • Fru Fru-6-P
  • Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|5EY7] (from Vibrio cholerae, 38% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|2E9D10B0FA5685800007222A5AAD71E975675DB1|gutB]-[gene|B13F7C35FBD55C674E5B19836D32279E7C1A5520|gutP]-[gene|0C4F0C9EF18FB4E9BB5BC3F53F7DDF5F32B51FA5|fruC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8195086], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]: activation, [Pubmed|8195086], in [regulon|926BCA197F259558F72FDCC73998497B9B167D22|GutR regulon]
  • regulation

  • induced by glucitol ([protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]) [Pubmed|8195086]
  • view in new tab

    genes
    [gene|0C4F0C9EF18FB4E9BB5BC3F53F7DDF5F32B51FA5|fruC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C213 (ydjE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2211 NBRP B. subtilis, Japan]
  • BKE06170 ([gene|0C4F0C9EF18FB4E9BB5BC3F53F7DDF5F32B51FA5|fruC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCACACTCATTTA, downstream forward: _UP4_TAAATCATTGAAGATGTTTC
  • BKK06170 ([gene|0C4F0C9EF18FB4E9BB5BC3F53F7DDF5F32B51FA5|fruC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCACACTCATTTA, downstream forward: _UP4_TAAATCATTGAAGATGTTTC