SubtiBank SubtiBank
tmcAL
The papers of the month are back! Check them out! Link here

tmcAL

tRNAMet cytidine acetate ligase, required for proper decoding of the AUA elongator Met codon
locus
BSU15060
pI
7.80
mw
46.83 kDa
protein length
415 aa Sequence Blast
gene length
1245 bp Sequence Blast
function
acetylation of elongator tRNAMet
product
tRNAMet cytidine acetate ligase
essential
no
synonyms
ylbM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    1,573,807 → 1,575,054

    Phenotypes of a mutant

  • cold-sensitive [pubmed|30150682]
  • restores viability of a ''[gene|0136394A52759CEEDD8DE074ED74033C6FFB8435|smc]'' mutant on rich medium due to the induction of a [SW|stringent response] [Pubmed|26539825]
  • The protein

    Catalyzed reaction/ biological activity

  • acetylation of the first position of the anticodon (position 34) of elongator tRNAMet [pubmed|30150682]
  • Protein family

  • UPF0348 family (according to Swiss-Prot)
  • Structure

  • [PDB|5Y0O] (apo-form) [pubmed|30150682]
  • [PDB|5Y0P] (bound to alpha-thio ATP) [pubmed|30150682]
  • [PDB|5Y0Q] (bound to AMPCPP) [pubmed|30150682]
  • [PDB|5Y0N] (selenomethionine derivative) [pubmed|30150682]
  • Expression and Regulation

    Operons

    genes
    [gene|0311601A6499C5B5A84690242132AC4AC1D36B26|ylzH]-[gene|0C76CAE27ACEBC0FF6B864B9F8C7D3C41C8D2A24|tmcAL]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B250 (ylbM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1249 NBRP B. subtilis, Japan]
  • BKE15060 (Δ[gene|0C76CAE27ACEBC0FF6B864B9F8C7D3C41C8D2A24|tmcAL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAACCACCAATCCGACAG, downstream forward: _UP4_AATGTATAGAAAAAGCACCT
  • BKK15060 (Δ[gene|0C76CAE27ACEBC0FF6B864B9F8C7D3C41C8D2A24|tmcAL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAACCACCAATCCGACAG, downstream forward: _UP4_AATGTATAGAAAAAGCACCT
  • References

  • 26539825,30150682