SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


tRNAMet cytidine acetate ligase, required for proper decoding of the AUA elongator Met codon
46.83 kDa
protein length
415 aa Sequence Blast
gene length
1248 bp Sequence Blast
acetylation of elongator tRNAMet
tRNAMet cytidine acetate ligase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    1,573,807 1,575,054

    Phenotypes of a mutant

  • cold-sensitive [pubmed|30150682]
  • restores viability of a ''[gene|0136394A52759CEEDD8DE074ED74033C6FFB8435|smc]'' mutant on rich medium due to the induction of a [SW|stringent response] [Pubmed|26539825]
  • The protein

    Catalyzed reaction/ biological activity

  • acetylation of the first position of the anticodon (position 34) of elongator tRNAMet [pubmed|30150682]
  • Protein family

  • TmcAL family (single member, according to UniProt)
  • Structure

  • [PDB|5Y0O] (apo-form) [pubmed|30150682]
  • [PDB|5Y0P] (bound to alpha-thio ATP) [pubmed|30150682]
  • [PDB|5Y0Q] (bound to AMPCPP) [pubmed|30150682]
  • [PDB|5Y0N] (selenomethionine derivative) [pubmed|30150682]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B250 (ylbM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15060 ([gene|0C76CAE27ACEBC0FF6B864B9F8C7D3C41C8D2A24|tmcAL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAACCACCAATCCGACAG, downstream forward: _UP4_AATGTATAGAAAAAGCACCT
  • BKK15060 ([gene|0C76CAE27ACEBC0FF6B864B9F8C7D3C41C8D2A24|tmcAL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAACCACCAATCCGACAG, downstream forward: _UP4_AATGTATAGAAAAAGCACCT
  • References

  • 26539825,30150682