SubtiBank SubtiBank
iseA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

iseA

inhibits in vitro activity of cell wall endopeptidases, inhibits cell separation
locus
BSU_18380
pI
10.18
mw
19.98 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
protection against cell envelope stress
product
inhibitor of autolysins
essential
no
synonyms
yoeB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,002,637 2,003,182

    The protein

    Structure

  • [PDB|2RSX] [Pubmed|23091053]
  • [SW|Localization]

  • localized to cell separation sites
  • Expression and Regulation

    Operons

    genes
    [gene|0CA55371306D4BD768CFA82027DCB4D581BCCB87|iseA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: repression, [Pubmed|17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • expression is modulated in response to D,L-endopeptidase activity (decreased upon reduced activity in the absence of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] or [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX], increased upon overexpression of [protein|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|LytE]) ([protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [pubmed|31808740]
  • induced by vancomycin [Pubmed|17483219]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B076 (yoeB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1075 NBRP B. subtilis, Japan]
  • BKE18380 ([gene|0CA55371306D4BD768CFA82027DCB4D581BCCB87|iseA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCGCTCTCTCCTTCA, downstream forward: _UP4_TAAGAAAAACGCCCGGTATA
  • BKK18380 ([gene|0CA55371306D4BD768CFA82027DCB4D581BCCB87|iseA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCGCTCTCTCCTTCA, downstream forward: _UP4_TAAGAAAAACGCCCGGTATA
  • References

  • 17581128,18761694,17483219,20059685,22383849,23091053,23033921,23199363,26883633,29458655,29465029,31808740