SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


control of DegU activity, enhances sigD transcription, part of the swrAA pseudogene
0.00 kDa
protein length
gene length
117 bp Sequence Blast
essential for swarming differentiation on solid surfaces
swarming motility protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    3,621,931 3,622,047

    The protein

  • see [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18567663], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|18567663], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, ([protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA] promoter) [Pubmed|18567663], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab


    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|18567663], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18567663], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, ([protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA] promoter) [Pubmed|18567663], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • additional information

  • SwrA levels are 3 ... 10-fold increased on solid medium as compared to liquid medium (due to [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA]/[protein|A6E7212D159F076F5D26F9C02F340B40C3667623|SmiA]-mediated degradation of SwrA in liquid medium) [PubMed|25538299]
  • view in new tab

    Biological materials

  • see [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]
  • Mutant

  • BKE35239 ([gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGCTAACGTTACTC, downstream forward: _UP4_GGTTCACAATTGAAGAGGGC
  • BKK35239 ([gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGCTAACGTTACTC, downstream forward: _UP4_GGTTCACAATTGAAGAGGGC
  • labs

  • see [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]
  • References

  • see [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]