SubtiBank SubtiBank
epsN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

epsN

UDP-2,6-dideoxy 2-acetamido 4-keto glucose aminotransferase, required for extracellular polysaccharide synthesis
locus
BSU_34230
pI
5.84
mw
42.76 kDa
protein length
388 aa Sequence Blast
gene length
1167 bp Sequence Blast
function
[category|SW 4.1.2|Biofilm formation], biosynthesis of N,N'-diacetylbacillosamine
product
UDP-2,6-dideoxy 2-acetamido 4-keto glucose aminotransferase
essential
no
synonyms
yvfE

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.1|Matrix polysaccharide synthesis]
  • Gene

    Coordinates
    3,515,062 3,516,228

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • The protein

    Catalyzed reaction/ biological activity

  • conversion of UDP-2,6-dideoxy 2-acetamido 4-keto glucose to UDP-2,6-dideoxy 2-acetamido 4-amino glucose [pubmed|29982582]
  • Protein family

  • DegT/DnrJ/EryC1 family (with [protein|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|NtdA] and [protein|38DBA751456A0C0EC5D028939ADB8860ADA28F94|SpsC], according to UniProt)
  • [SW|Cofactors]

  • pyridoxal phosphate [pubmed|29982582]
  • Structure

  • [PDB|1O61] (from Campylobacter jejuni, 46% identity) [SW|16021622]
  • Expression and Regulation

    Operons

    genes
    [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
    description
    [Pubmed|15661000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A064 (yvfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/64 NBRP B. subtilis, Japan]
  • BKE34230 ([gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGTAGATTTTTTTATGCA, downstream forward: _UP4_TTCCATACTGTCGAGGTGAA
  • BKK34230 ([gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGTAGATTTTTTTATGCA, downstream forward: _UP4_TTCCATACTGTCGAGGTGAA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

    Reviews

  • 20735481
  • Research papers

  • 29982582,30222950,16021622
  • The EAR [SW|RNA switch]

  • 20374491,20230605