SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional repressor ([SW|MarR family]), controls the expression of genes involved in pulcherriminic acid biosynthesis
19.54 kDa
protein length
169 aa Sequence Blast
gene length
507 bp Sequence Blast
control of pulcherriminic acid biosynthesis
transcription factor ([SW|MarR family])

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|Acquisition of iron / Other]
  • Gene

    3,604,993 → 3,605,502

    Phenotypes of a mutant

  • inactivation of ''[gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]'' causes widespread disruption of proteins involved in cellular processes that depend on iron availability, with pleiotropic effects on proteins associated with carbon metabolism, translation, stress response, biosynthesis of cell wall, and sporulation initiation [Pubmed|27542896]
  • The protein

    Protein family

  • [SW|MarR family] of transcriptional regulators [Pubmed|27542896]
  • Additional information

  • Proposed consensus sequence for DNA-binding site: GTTYMMYMGTAAAC [Pubmed|27542896]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135]; [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR] auto-repression [Pubmed|27542896], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR]: repression, in [regulon|0D555F2AB7DC863E6FF388888308E980514DB719|PchR regulon]
  • regulation

  • induced by iron starvation [Pubmed|27542896]
  • view in new tab

    Biological materials


  • CS217 (''[gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE35080 (Δ[gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT, downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC
  • BKK35080 (Δ[gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT, downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC
  • Labs working on this gene/protein

  • Sandrine Auger, Micalis Institute, INRA, AgroParisTech, France
  • References

  • 12850135,22383849,27542896,27197833