SubtiBank SubtiBank
yxxD
The papers of the month are back! Check them out! Link here

yxxD

antitoxin
locus
BSU39290
pI
3.93
mw
17.52 kDa
protein length
147 aa Sequence Blast
gene length
441 bp Sequence Blast
function
inhibition of the cytotoxic activity of YxiD
product
antitoxin
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    4,036,344 → 4,036,787

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • Expression and Regulation

    Operons

    genes
    [gene|BD8C0563C7123B6DEC1EEB602BDF2C9D92D34991|yxiD]-[gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]-[gene|2710D9FD5FA50E09B4E482C13140F69B13C71861|yxxE]
    description
    [Pubmed|7883710,10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B786 (yxxD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1785 NBRP B. subtilis, Japan]
  • BKE39290 (Δ[gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATTTTTTTTTGCCTCC, downstream forward: _UP4_TGATTTTAACATTATCCCGT
  • BKK39290 (Δ[gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATTTTTTTTTGCCTCC, downstream forward: _UP4_TGATTTTAACATTATCCCGT
  • References

  • 7883710,10746760,22200572,28189581