SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


extracellular lipase
22.64 kDa
protein length
212 aa Sequence Blast
gene length
639 bp Sequence Blast
lipid degradation
extracellular lipase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of lipids/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    292,205 292,843

    The protein

    Catalyzed reaction/ biological activity

  • triacylglycerol + H2O --> diacylglycerol + fatty acid + H+ (according to UniProt)
  • Protein family

  • [SW|AB hydrolase superfamily] (according to UniPort)
  • Paralogous protein(s)

  • [protein|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|LipB]
  • Structure

  • [PDB|2QXT] [pubmed|18053819]
  • [PDB|1I6W]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during vegetative growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • BKE02700 ([gene|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATCCTCCTTTTTTT, downstream forward: _UP4_TAATGAAAAACAAAACCTTG
  • BKK02700 ([gene|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATCCTCCTTTTTTT, downstream forward: _UP4_TAATGAAAAACAAAACCTTG
  • References

  • 22996591,22267088,23404771,21477088,22246996,23639749,21815947,24402332,15812018,12523966,18721749,12218047,16342303,12951259,11583117,11491291,18383241,19180538,8396026,19883129,18840696,18053819,24827611,12077437,25122499,25495458,26147762,26488405,27003415,27239434,27696241,28050632,18053819,30286107,31553080,32183336