SubtiBank SubtiBank
ypsC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ypsC

similar to SAM-dependent 23S rRNA methyltransferase
locus
BSU_22170
pI
8.01
mw
43.35 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
function
rRNA modification
product
23S rRNA methyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    2,330,075 2,331,232

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|Domains]

  • THUMP domain (aa 44-156) (according to UniProt)
  • Structure

  • [PDB|3K0B] (from Listeria monocytogenes, 63% identity)
  • additional information

  • [protein|0DF27BEAF763545258CE7DD56F65CD5BF74DD887|YpsC] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation

    Operons

    genes
    [gene|C22F7704DC9D36D96FE089ADCEA546D7A3FB3739|gpsB]-[gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|rnpB]-[gene|0DF27BEAF763545258CE7DD56F65CD5BF74DD887|ypsC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|rnpB]-[gene|0DF27BEAF763545258CE7DD56F65CD5BF74DD887|ypsC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A416 (ypsC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/416 NBRP B. subtilis, Japan]
  • BKE22170 ([gene|0DF27BEAF763545258CE7DD56F65CD5BF74DD887|ypsC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCACCCTGTCTTT, downstream forward: _UP4_TAAAAAGAAGACGCTCTGCA
  • BKK22170 ([gene|0DF27BEAF763545258CE7DD56F65CD5BF74DD887|ypsC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCACCCTGTCTTT, downstream forward: _UP4_TAAAAAGAAGACGCTCTGCA
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • References

  • 17010378,21710567