SubtiBank SubtiBank
sdhA
The papers of the month are back! Check them out! Link here

sdhA

succinate dehydrogenase (flavoprotein subunit)
locus
BSU28440
pI
5.71
mw
65.17 kDa
protein length
586 aa Sequence Blast
gene length
1758 bp Sequence Blast
function
TCA cycle
product
succinate dehydrogenase (flavoprotein subunit)
essential
no
synonyms
citF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    2,906,335 → 2,908,095

    The protein

    Catalyzed reaction/ biological activity

  • Succinate + acceptor = fumarate + reduced acceptor (according to Swiss-Prot)
  • Protein family

  • FRD/SDH subfamily (according to Swiss-Prot)
  • Modification

  • phosphorylated [Pubmed|16493705], [Pubmed|17726680]
  • [SW|Cofactors]

  • Fe
  • Effectors of protein activity

  • Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide [Pubmed|3910107]
  • Activated by Cytochrome b558 [Pubmed|6799760]
  • Structure

  • [PDB|1NEK] (''E. coli'') [pubmed|12560550]
  • [SW|Localization]

  • attached to the membrane [Pubmed|18763711]
  • Additional information

  • This enzyme is a membrane-bound trimer [Pubmed|3910107] [Pubmed|6799760]
  • One subunit is bound to cytochrome b558, and this subunit is the one bound to the cytosolic side of the membrane [Pubmed|3910107] [Pubmed|6799760]
  • Another subunit is the flavoprotein one, required for FAD usage [Pubmed|3910107] [Pubmed|6799760]
  • The other subunit has an iron-sulphur domain necessary for the catalytic activity [Pubmed|3910107] [Pubmed|6799760]
  • extensive information on the structure and enzymatic properties of succinate dehydrogenase can be found at [http://www.proteopedia.org/wiki/index.php/Succinate_Dehydrogenase Proteopedia]
  • Expression and Regulation

    Operons

    genes
    [gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]
    description
    [Pubmed|3036777]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2495271], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition, [Pubmed|22389480]
  • Biological materials

    Mutant

  • GP743 (''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]'', cat), available in [SW|Jörg Stülke]'s lab
  • GP792 (''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • GP2342 (''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]''::''kan''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2343 (''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]''::''lox72''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE28440 (Δ[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGCCCCTCTCCCTC, downstream forward: _UP4_AAGAAGAAGGTGGCGAAATA
  • BKK28440 (Δ[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGCCCCTCTCCCTC, downstream forward: _UP4_AAGAAGAAGGTGGCGAAATA
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 11803018
  • Original publications

  • 2987185,1707123,6401289,6406223,1324713,3036777,2495271,3027051,22389480,17726680,18763711,17726680,16493705,3910107,6799760,12560550,23651456,23880299,12560550