SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


succinate dehydrogenase (flavoprotein subunit)
65.17 kDa
protein length
586 aa Sequence Blast
gene length
1761 bp Sequence Blast
TCA cycle
succinate dehydrogenase (flavoprotein subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    2,906,335 2,908,095

    The protein

    Catalyzed reaction/ biological activity

  • quinone + succinate --> quinol + fumarate (according to UniProt)
  • Protein family

  • FAD-dependent oxidoreductase 2 family (with [protein|D30D059185DFB828AB0FD07D600DBC3FD0973198|NadB], according to UniProt)
  • Modification

  • phosphorylated [Pubmed|16493705], [Pubmed|17726680]
  • [SW|Cofactors]

  • Fe
  • FAD (according to UniProt)
  • Effectors of protein activity

  • Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide [Pubmed|3910107]
  • Activated by Cytochrome b558 [Pubmed|6799760]
  • Structure

  • [PDB|1NEK] (''E. coli'') [pubmed|12560550]
  • [SW|Localization]

  • attached to the membrane [Pubmed|18763711]
  • Additional information

  • This enzyme is a membrane-bound trimer [Pubmed|3910107] [Pubmed|6799760]
  • One subunit is bound to cytochrome b558, and this subunit is the one bound to the cytosolic side of the membrane [Pubmed|3910107] [Pubmed|6799760]
  • Another subunit is the flavoprotein one, required for FAD usage [Pubmed|3910107] [Pubmed|6799760]
  • The other subunit has an iron-sulphur domain necessary for the catalytic activity [Pubmed|3910107] [Pubmed|6799760]
  • extensive information on the structure and enzymatic properties of succinate dehydrogenase can be found at [ Proteopedia]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2495271], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition, [Pubmed|22389480]
  • Biological materials


  • GP743 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]''), cat, available in [SW|Jörg Stülke]'s lab
  • GP792 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''phleo'', available in [SW|Jörg Stülke]'s lab
  • GP2342 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2343 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE28440 ∆([gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA])::erm trpC2 available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGCCCCTCTCCCTC, downstream forward: _UP4_AAGAAGAAGGTGGCGAAATA
  • BKK28440 ∆([gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]::kan) trpC2 available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGCCCCTCTCCCTC, downstream forward: _UP4_AAGAAGAAGGTGGCGAAATA
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 11803018
  • Original publications

  • 2987185,1707123,6401289,6406223,1324713,3036777,2495271,3027051,22389480,17726680,18763711,17726680,16493705,3910107,6799760,12560550,23651456,23880299,12560550