SubtiBank SubtiBank
azoR2
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

azoR2

similar to NAD(P)H dehydrogenase (quinone)
locus
BSU_33540
pI
5.11
mw
23.13 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
function
resistance to 2-methylhydroquinone
product
azoreductase
essential
no
synonyms
yvaB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,445,442 3,446,077

    The protein

    Catalyzed reaction/ biological activity

  • anthranilate + N,N-dimethyl-1,4-phenylenediamine + 2 NAD+ --> 2-(4-dimethylaminophenyl)diazenylbenzoate + 2 H+ + 2 NADH (according to UniProt)
  • Protein family

  • azoreductase type 1 family (with [protein|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|AzoR1], according to UniProt)
  • Paralogous protein(s)

  • [protein|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|AzoR1]
  • Structure

  • [PDB|3P0R] (from B. anthracis, 43% identity, 61% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]
    description
    [Pubmed|17725564]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725564], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]: repression, [Pubmed|17725564], in [regulon|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR regulon]
  • regulation

  • induced by catechol and 2-methylhydroquinone (2-MHQ) ([protein|search|MhqR]) [Pubmed|17725564]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A444 (yvaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/444 NBRP B. subtilis, Japan]
  • BKE33540 ([gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCAGCCCTTTCG, downstream forward: _UP4_TAATGAAAAAGCCTCCCCTT
  • BKK33540 ([gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCAGCCCTTTCG, downstream forward: _UP4_TAATGAAAAAGCCTCCCCTT
  • References

  • 17725564,18208493,16497325,12107147,27965289