SubtiBank SubtiBank
yerO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yerO

similar to transcriptional regulator ([SW|TetR family])
locus
BSU_06700
pI
5.33
mw
32.69 kDa
protein length
289 aa Sequence Blast
gene length
870 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    731,954 732,823

    The protein

    Protein family

  • [SW|TetR family]
  • Structure

  • [PDB|1VI0]
  • Expression and Regulation

    Operons

    genes
    [gene|0EA09C351B612320A560BF1E0B0188D94D2F8A05|yerO]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A929 (yerO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/929 NBRP B. subtilis, Japan]
  • BKE06700 ([gene|0EA09C351B612320A560BF1E0B0188D94D2F8A05|yerO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACGTGCTTCCCCTTAA, downstream forward: _UP4_AGCCTCTAAGGGCTGCTTTT
  • BKK06700 ([gene|0EA09C351B612320A560BF1E0B0188D94D2F8A05|yerO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACGTGCTTCCCCTTAA, downstream forward: _UP4_AGCCTCTAAGGGCTGCTTTT
  • References

    Reviews

  • 24006471