SubtiBank SubtiBank
bacB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bacB

oxidase that catalyzes the synthesis of 2-oxo-3-(4-oxocyclohexa-2,5-dienyl)propanoic acid, a precursor to L-anticapsin
locus
BSU_37730
pI
5.19
mw
26.69 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
function
biosynthesis of the antibiotic bacilysin
product
oxidase
essential
no
synonyms
ywfC,ipa-81d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    3,872,869 3,873,576

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of 2-oxo-3-(4-oxocyclohexa-2,5-dienyl)propanoic acid, a precursor to L-anticapsin [Pubmed|19776011]
  • 3-[(4R)-4-hydroxycyclohexa-1,5-dien-1-yl]-2-oxopropanoate --> 3-[(1E,4R)-4-hydroxycyclohex-2-en-1-ylidene]pyruvate (according to UniProt)
  • [SW|Domains]

  • 2 [SW|cupin 2 domain]s (aa 41 ... 106, aa 151 ... 216)
  • Structure

  • [PDB|3H7J] [Pubmed|19776011]
  • Expression and Regulation

    Operons

    genes
    [gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
    description
    [Pubmed|12372825]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B240 (ywfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1239 NBRP B. subtilis, Japan]
  • BKE37730 ([gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAATAAAGCTCCTGCATAT, downstream forward: _UP4_AAAATGAAGGCGGATGAATG
  • BKK37730 ([gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAATAAAGCTCCTGCATAT, downstream forward: _UP4_AAAATGAAGGCGGATGAATG
  • References

  • 15609023,12372825,21948839,19776011,19801406,20052993,20445239