SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


2-dehydropantoate 2-reductase
33.13 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
biosynthesis of coenzyme A
2-dehydropantoate 2-reductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of coenzyme A]
  • Gene

    1,577,409 1,578,305

    The protein

    Catalyzed reaction/ biological activity

  • (R)-pantoate + NADP+ --> 2-dehydropantoate + H+ + NADPH (according to UniProt)
  • Protein family

  • ketopantoate reductase family (with [protein|60264E4BE76F5995A8317294D05FC27F8B34E09D|YkpB], according to UniProt)
  • Structure

  • [PDB|3LGO]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • ''[protein|search|ylbQ]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials


  • MGNA-B254 (ylbQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15110 ([gene|0F153803781C9AC8321FB14F926B645C45E53B00|ylbQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCACACCCAATTT, downstream forward: _UP4_TGAGCTTTTTCGGTAACATG
  • BKK15110 ([gene|0F153803781C9AC8321FB14F926B645C45E53B00|ylbQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCACACCCAATTT, downstream forward: _UP4_TGAGCTTTTTCGGTAACATG
  • References

    Operon and expression

  • 20308541,23894131