SubtiBank SubtiBank
yqeB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqeB

unknown
locus
BSU_25740
pI
6.55
mw
27.44 kDa
protein length
241 aa Sequence Blast
gene length
723 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,651,632 → 2,652,354

    The protein

    [SW|Localization]

  • membrane protein (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0F202BE8ED62BF5A51BF0A7DFAA5E2DB3D44065E|yqeB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25740 (Δ[gene|0F202BE8ED62BF5A51BF0A7DFAA5E2DB3D44065E|yqeB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCACCTTCTTTTTACT, downstream forward: _UP4_TAACAACAGAGGCTCAAGAA
  • BKK25740 (Δ[gene|0F202BE8ED62BF5A51BF0A7DFAA5E2DB3D44065E|yqeB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCACCTTCTTTTTACT, downstream forward: _UP4_TAACAACAGAGGCTCAAGAA