SubtiBank SubtiBank
yutH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yutH

spore coat protein
locus
BSU_32270
pI
6.01
mw
40.09 kDa
protein length
339 aa Sequence Blast
gene length
1020 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.3|Class III]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,316,330 3,317,349

    The protein

    Protein family

  • cotS family (with [protein|D57116C65FD11EF92FB5D2945B10A1D024AEFF22|CotI] and [protein|DC99E507696A1CB23140A1CBA45DA07D1F7C7D53|CotS], according to UniProt)
  • [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH]-[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A972 (yutH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/972 NBRP B. subtilis, Japan]
  • BKE32270 ([gene|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCACCTGCCTGTTGA, downstream forward: _UP4_TGAGGAGAAAATCTGACAAA
  • BKK32270 ([gene|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCACCTGCCTGTTGA, downstream forward: _UP4_TGAGGAGAAAATCTGACAAA
  • References

  • 15231775,22171814,21926231,15383836