SubtiBank SubtiBank
adaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

adaA

trigger enzyme
locus
BSU_01810
pI
9.19
mw
24.15 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
function
adaptive response to alkylative DNA damage
product
trigger enzyme
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.3|Trigger enzymes that act directly as transcription factors by binding DNA]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    Coordinates
    203,729 204,364

    The protein

    Catalyzed reaction/ biological activity

  • methylphosphotriester deoxyribonucleoside in DNA + L-cysteinyl-[protein] --> deoxyribonucleotide in DNA + H+ + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • Protein family

  • [SW|AraC family]
  • Structure

  • [PDB|1ZGW] (from E. coli, 39% identity) [pubmed|16209950]
  • Expression and Regulation

    Operons

    genes
    [gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]-[gene|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|adaB]
    description
    [Pubmed|2120677]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2120677], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA]: positive regulation, in [regulon|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA regulon]
  • regulation

  • positive control by [protein|search|AdaA] [Pubmed|2120677]
  • view in new tab

    Biological materials

    Mutant

  • BKE01810 ([gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCACCTCTCCTT, downstream forward: _UP4_ATGAGTAAAATGGAGGAAAC
  • BKK01810 ([gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCACCTCTCCTT, downstream forward: _UP4_ATGAGTAAAATGGAGGAAAC
  • References

    Reviews

  • 22933559,24810496
  • Original publications

  • 2120677,8376346,23504016,16209950