SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


trigger enzyme
24.15 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
adaptive response to alkylative DNA damage
trigger enzyme

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW|Trigger enzymes that act directly as transcription factors by binding DNA]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    203,729 204,364

    The protein

    Catalyzed reaction/ biological activity

  • methylphosphotriester deoxyribonucleoside in DNA + L-cysteinyl-[protein] --> deoxyribonucleotide in DNA + H+ + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • Protein family

  • [SW|AraC family]
  • [SW|Domains]

  • [SW|HTH araC/xylS-type domain] (aa 102-200) (according to UniProt)
  • Structure

  • [PDB|1ZGW] (from E. coli, 39% identity) [pubmed|16209950]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2120677], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA]: positive regulation, in [regulon|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA regulon]
  • regulation

  • positive control by [protein|search|AdaA] [Pubmed|2120677]
  • view in new tab

    Biological materials


  • BKE01810 ([gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCACCTCTCCTT, downstream forward: _UP4_ATGAGTAAAATGGAGGAAAC
  • BKK01810 ([gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCACCTCTCCTT, downstream forward: _UP4_ATGAGTAAAATGGAGGAAAC
  • References


  • 22933559,24810496
  • Original publications

  • 2120677,8376346,23504016,16209950