SubtiBank SubtiBank
yozG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozG

similar to transcription regulator ([SW|Xre family])
locus
BSU_18740
pI
8.45
mw
9.18 kDa
protein length
gene length
255 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,043,678 2,043,932

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 7-62) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E2F9D7C9BC9166AD462E0017F50BDD9ECF9C6835|yoaS]-[gene|10484E5BB5DC0117CDE97036AF82F04F07926AEF|yozG]-[gene|694BC1E02DBAC48CC2BEEFCADED7889BC18E363C|yoaT]-[gene|A23D34C5D38A48144B062C3BAF9BDF38CEA1207F|yoaV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE18740 ([gene|10484E5BB5DC0117CDE97036AF82F04F07926AEF|yozG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATAATAATCGCCATGTCAT, downstream forward: _UP4_TAAAGTGATTGGCGGTGAGC
  • BKK18740 ([gene|10484E5BB5DC0117CDE97036AF82F04F07926AEF|yozG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATAATAATCGCCATGTCAT, downstream forward: _UP4_TAAAGTGATTGGCGGTGAGC
  • References

  • 23504016