SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


3-isopropylmalate dehydrogenase
39.79 kDa
protein length
365 aa Sequence Blast
gene length
1098 bp Sequence Blast
biosynthesis of leucine
3-isopropylmalate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,891,020 2,892,117

    The protein

    Catalyzed reaction/ biological activity

  • (2R,3S)-3-isopropylmalate + NAD+ --> 4-methyl-2-oxopentanoate + CO2 + NADH (according to UniProt)
  • Protein family

  • Isocitrate and isopropylmalate dehydrogenases family (with [protein|CB7D0E32C044D541CD966DC1F9DA489D518A7703|Icd] and [protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|YcsA], according to UniProt)
  • Paralogous protein(s)

  • [protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|YcsA]
  • Modification

  • phosphorylated on Arg-4 [Pubmed|22517742]
  • Structure

  • [PDB|1XAD] (Thermus thermophilus)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1577690], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: termination/antitermination, via tRNA controlled [SW|RNA switch], repression by BCAA, in [regulon|T-box|T-box]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|15547269], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|12193635], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [PubMed|12193635]
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • 1A618 ( ''leuB''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • BKE28270 ([gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTAACCGTTCTCCTTT, downstream forward: _UP4_TGACAGCTTACGTTAAGCGG
  • BKK28270 ([gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTAACCGTTCTCCTTT, downstream forward: _UP4_TGACAGCTTACGTTAAGCGG
  • References

  • 15060025,12193635,19258532,8289305,18641142,22517742,15547269,12618455,12107147,20935095,25157083,24163341,25755103,15378759,26220295