SubtiBank SubtiBank
dctP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dctP

uptake of succinate, fumurate, malate and oxaloacetate via proton symport
locus
BSU_04470
pI
8.67
mw
45.28 kDa
protein length
421 aa Sequence Blast
gene length
1266 bp Sequence Blast
function
uptake of succinate, fumurate, malate and oxaloacetate
product
C4-dicarboxylate transport protein
essential
no
synonyms
ydbH,dctA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    500,166 501,431

    The protein

    Catalyzed reaction/ biological activity

  • uptake of succinate, fumurate, malate and oxaloacetate via proton symport [Pubmed|20363944]
  • acts as co-sensor for [protein|9A96572B101358768EB20EE9438BE0E1424A4130|DctS] [Pubmed|24375102]
  • Protein family

  • [SW|dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|GltT], [protein|622856EE642C42247C658DBD57E6A18C6E81FE58|GltP]
  • Structure

  • [PDB|4KY0] (the glutamate transporter of ''Thermococcus kodakarensis'', 31% identity, 71% similarity) [Pubmed|24013209]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]
    description
    [Pubmed|10708364]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10708364], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: indirect effect, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • part of the iron sparing response, strong down-regulation in a'' [protein|search|fur]'' mutant ([protein|search|Fur], [protein|search|FsrA]) [Pubmed|22389480]
  • view in new tab

    genes
    [gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]-[gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]-[gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]
    description
    [Pubmed|10708364]

    regulation

  • part of the iron sparing response, strong down-regulation in a'' [protein|search|fur]'' mutant ([protein|search|Fur], [protein|search|FsrA]) [Pubmed|22389480]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition, [Pubmed|22389480]
  • Biological materials

    Mutant

  • BKE04470 ([gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCTTCATCCCCCTGT, downstream forward: _UP4_TGAAAAAAGAACGGCCCATC
  • BKK04470 ([gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCTTCATCCCCCTGT, downstream forward: _UP4_TGAAAAAAGAACGGCCCATC
  • GP2600 ([gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 12850135,10708364,10627041,12949159,20363944,22389480,22900538,24013209,24375102