SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


(p)ppGpp synthetase, small alarmone synthetase
24.45 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
ppGpp synthesis independent from stringent response
(p)ppGpp synthetase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    3,949,952 3,950,584

    Phenotypes of a mutant

  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24163341]
  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant acquires suppressor mutations in ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24682323,24163341]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)
  • Protein family

  • RelA/SpoT family (with [protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|SasB] and [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA], according to UniProt)
  • Paralogous protein(s)

  • [protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|SasB]
  • [SW|Domains]

  • single ppGpp synthetase domain [Pubmed|24163341]
  • Structure

  • [PDB|6FGK] [Pubmed|29391580]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421,11866510,18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: repression, [pubmed|31723135], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] mutant [Pubmed|21926231]
  • exhibits high levels of extrinsic noise in expression (mediated via [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC]-dependent phosphorylation of [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] on Thr-101) [pubmed|31723135]
  • view in new tab

    Biological materials


  • GP3424(''Δ''''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]''::''spec''), available in [SW|Jörg Stülke]'s lab
  • MGNA-B218 (ywaC::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2066 (''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::mls''), available in [SW|Jörg Stülke]'s lab
  • BKE38480 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA, downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
  • BKK38480 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA, downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
  • References


  • 27149325,,30980074
  • Original publications

  • 29391580,21926231,22950019,18670626,19447912,18067544,19477419,12207695,11866510,18179421,24163341,24489751,24687489,24682323,26460002,27875634,31723135