SubtiBank SubtiBank
sigL
The papers of the month are back! Check them out! Link here

sigL

[SW|sigma factor ]of the [SW|RNA polymerase], Sigma-54, Sigma L
locus
BSU34200
pI
7.79
mw
49.54 kDa
protein length
436 aa Sequence Blast
gene length
1308 bp Sequence Blast
function
utilization of arginin, acetoin and fructose, required for cold adaptation
product
[SW|RNA polymerase] sigma-54 factor (sigma-L)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • Gene

    Coordinates
    3,512,498 → 3,513,808

    Phenotypes of a mutant

  • The mutant is cold-sensitive and unable to use arginine as a single carbon source [pubmed|16585774]
  • The protein

    Catalyzed reaction/ biological activity

  • Binding to promoters of the -12, -24 type
  • Protein family

  • sigma-54 factor family (according to Swiss-Prot)
  • [SW|Domains]

  • DNA binding domain (HTH motif) (324–343)
  • pron box domain (413–421)
  • 3 x Compositional bias domain (6–21),(32–53),(112–136)
  • Structure

  • [PDB|5BYH] (''E. coli'' [SW|RNA polymerase] containing Sigma-54) [Pubmed|26293966]
  • Additional information

  • Transcription initiation by SigL-containing [SW|RNA polymerase] requires the activity of ATP-hydrolyzing transcription activators
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000078 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/sigL.html DBTBS]) null

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, transcriptional roadblock [Pubmed|16166551], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|16166551]
  • view in new tab

    Biological materials

    Mutant

  • GP146 (''sigL''::spc), available in [SW|Jörg Stülke]'s lab [Pubmed|17183217]
  • GP2302 (''sigL''::tet), available in [SW|Jörg Stülke]'s lab
  • 1A914 (''sigL''::''kan''), [Pubmed|16585774], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A914&Search=1A914 BGSC]
  • BKE34200 (Δ[gene|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT, downstream forward: _UP4_TAAAATCCTCCCTAGACGGG
  • BKK34200 (Δ[gene|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT, downstream forward: _UP4_TAAAATCCTCCCTAGACGGG
  • Labs working on this gene/protein

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
  • References

    Reviews

  • 7934866,10894718,21054445,26010401,21906631
  • Original publications

  • 16585774,11274109,1924373,16166551,22900538,26293966,24553251