SubtiBank SubtiBank
sigL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sigL

[SW|sigma factor ]of the [SW|RNA polymerase], Sigma-54, Sigma L
locus
BSU_34200
pI
7.79
mw
49.54 kDa
protein length
436 aa Sequence Blast
gene length
1311 bp Sequence Blast
function
utilization of arginin, acetoin and fructose, required for cold adaptation
product
[SW|RNA polymerase] sigma-54 factor (sigma-L)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • Gene

    Coordinates
    3,512,498 3,513,808

    Phenotypes of a mutant

  • The mutant is cold-sensitive and unable to use arginine as a single carbon source [pubmed|16585774]
  • The protein

    Catalyzed reaction/ biological activity

  • Binding to promoters of the -12, -24 type
  • Protein family

  • sigma-54 factor family (single member, according to UniProt)
  • [SW|Domains]

  • DNA binding domain (HTH motif) (324343)
  • pron box domain (413421)
  • 3 x Compositional bias domain (621),(3253),(112136)
  • Structure

  • [PDB|5BYH] (''E. coli'' [SW|RNA polymerase] containing Sigma-54) [Pubmed|26293966]
  • Additional information

  • Transcription initiation by SigL-containing [SW|RNA polymerase] requires the activity of ATP-hydrolyzing transcription activators
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000078 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, transcriptional roadblock [Pubmed|16166551], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|16166551]
  • view in new tab

    Biological materials

    Mutant

  • GP146 (Δ''sigL''::spc), available in [SW|Jörg Stülke]'s lab [Pubmed|17183217]
  • GP2302 (Δ''sigL''::tet), available in [SW|Jörg Stülke]'s lab
  • 1A914 (''sigL''::''kan''), [Pubmed|16585774], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A914&Search=1A914 BGSC]
  • BKE34200 (Δ[gene|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT, downstream forward: _UP4_TAAAATCCTCCCTAGACGGG
  • BKK34200 (Δ[gene|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT, downstream forward: _UP4_TAAAATCCTCCCTAGACGGG
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
  • References

    Reviews

  • 7934866,10894718,21054445,26010401,21906631
  • Original publications

  • 16585774,11274109,1924373,16166551,22900538,26293966,24553251