SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


uncharacterized FAD-linked oxidoreductase
40.96 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    957,705 959,060

    The protein

    Protein family

  • oxygen-dependent FAD-linked oxidoreductase family (with [protein|23F2385D14DDD5C400DC897E0F0FC814ACFC36B8|YitY] and [protein|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|CotQ], according to UniProt)
  • Paralogous protein(s)

  • [protein|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|CotQ]:
  • [SW|Domains]

  • [SW|FAD-binding PCMH-type domain] (aa 29-204) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3W8W] (from ''Streptomyces maritimus'', 33%)
  • Expression and Regulation




  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-A246 (ygaK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08800 ([gene|11499CDC836A40E857B8F5AD746BA2C650DC916B|ygaK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCCCACATCTCTTTC, downstream forward: _UP4_TAAAAAAATGAAGATGGAGC
  • BKK08800 ([gene|11499CDC836A40E857B8F5AD746BA2C650DC916B|ygaK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCCCACATCTCTTTC, downstream forward: _UP4_TAAAAAAATGAAGATGGAGC
  • References

  • 22383849,27766092