SubtiBank SubtiBank
ygaK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ygaK

uncharacterized FAD-linked oxidoreductase
locus
BSU_08800
pI
7.12
mw
40.96 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    957,705 959,060

    The protein

    Protein family

  • oxygen-dependent FAD-linked oxidoreductase family (with [protein|23F2385D14DDD5C400DC897E0F0FC814ACFC36B8|YitY] and [protein|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|CotQ], according to UniProt)
  • Paralogous protein(s)

  • [protein|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|CotQ]:
  • [SW|Domains]

  • [SW|FAD-binding PCMH-type domain] (aa 29-204) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3W8W] (from ''Streptomyces maritimus'', 33%)
  • Expression and Regulation

    Operons

    genes
    [gene|11499CDC836A40E857B8F5AD746BA2C650DC916B|ygaK]
    description
    [Pubmed|22383849]

    regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A246 (ygaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/246 NBRP B. subtilis, Japan]
  • BKE08800 ([gene|11499CDC836A40E857B8F5AD746BA2C650DC916B|ygaK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCCCACATCTCTTTC, downstream forward: _UP4_TAAAAAAATGAAGATGGAGC
  • BKK08800 ([gene|11499CDC836A40E857B8F5AD746BA2C650DC916B|ygaK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCCCACATCTCTTTC, downstream forward: _UP4_TAAAAAAATGAAGATGGAGC
  • References

  • 22383849,27766092