SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flottilin-like protein (in addition to [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT]), resistence protein (against sublancin), accessory role in resistance to cefuroxime
35.48 kDa
protein length
331 aa Sequence Blast
gene length
996 bp Sequence Blast
control of membrane fluidity
flottilin-like protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.7|Membrane dynamics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,617,449 2,618,444

    Phenotypes of a mutant

  • reduced [SW|protein secretion] [Pubmed|23651456]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' double mutant does not induce [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC]-dependent biofilm formation upon addition of surfactin [Pubmed|20713508]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' double mutant has a strong synthetic defect in motility, cell morphology, and transformation efficiency [Pubmed|22753055]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' double mutant has a [SW|sporulation] defect, due to the lack of [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH] [Pubmed|22882210]
  • a ''[gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' mutant produces increased amount of pulcherriminic acid [Pubmed|25909364]
  • a ''[gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' mutant has reduced sensitivity to vancomycin [Pubmed|25909364]
  • The protein

    Catalyzed reaction/ biological activity

  • controls protease activity of [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH] [Pubmed|24222488]
  • Protein family

  • UPF0365 family (single member, according to UniProt)
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • co-localizes with [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] in discrete foci in the membrane [Pubmed|20713508]
  • forms focal structure in the cytoplasma membrane [Pubmed|22753055]
  • 13 foci [protein|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|FloA] of are detected in strain 3610 [Pubmed|25909364]
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed under stress conditions ([protein|search|SigW]) [Pubmed|11866510]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • MGNA-C443 (yqfA::erm), available at the [ NBRP B. subtilis, Japan]
  • JS119 (3610 markerless), available in [SW|Daniel Lopez]'s lab
  • DL1401 (168 ''floA''::mls), available in [SW|Daniel Lopez]'s lab
  • BKE25380 ([gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAACTTCTCCTCGTTT, downstream forward: _UP4_TAATCTCTCTAAGAAGGGAG
  • BKK25380 ([gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAACTTCTCCTCGTTT, downstream forward: _UP4_TAATCTCTCTAAGAAGGGAG
  • GFP fusion

  • GK192 (3610 ''lacA''::P''floT-yfp''(mls)), available in [SW|Daniel Lopez]'s lab
  • JS136 (3610 ''amyE::floT''-gfp(spc)), available in [SW|Daniel Lopez]'s lab
  • JS134 (3610 ''lacA::floA''-mEos2 (mls)), available in [SW|Daniel Lopez]'s lab
  • JS167 (3610 ''lacA::floA''-PAmCherry (mls)), available in [SW|Daniel Lopez]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]) for FloA [Pubmed|25909364], available in [SW|Daniel Lopez]'s lab
  • References


  • 25652542
  • Original publications

  • 16629676,11866510,18763711,20713508,22753055,22882210,23651456,22178969,24222488,25909364,26297017,27362352,26883633,32662773