SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


42.63 kDa
protein length
387 aa Sequence Blast
gene length
1164 bp Sequence Blast
biosynthesis of methionine

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    3,228,778 3,229,941

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L,L-cystathionine --> L-homocysteine + NH4+ + pyruvate (according to UniProt)
  • Protein family

  • [SW|class-II pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3T32] (from ''B. anthracis'', 46% identity, 75% similarity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • 1A952 ( ''patB''::''cat''), [Pubmed|15760717], available at [ BGSC]
  • BKE31440 ([gene|11B54D438CDD2EAA4A87A6B99851A3B123EA4A1F|patB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTACCCCCTCATG, downstream forward: _UP4_TAAATATAGCTGTAAACGCC
  • BKK31440 ([gene|11B54D438CDD2EAA4A87A6B99851A3B123EA4A1F|patB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTACCCCCTCATG, downstream forward: _UP4_TAAATATAGCTGTAAACGCC
  • References

  • 9274030,15760717