SubtiBank SubtiBank
argF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

argF

ornithine carbamoyltransferase
locus
BSU_11250
pI
4.97
mw
34.51 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
biosynthesis of arginine
product
ornithine carbamoyltransferase
essential
no
ec
2.1.3.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • Gene

    Coordinates
    1,203,461 1,204,420

    The protein

    Catalyzed reaction/ biological activity

  • carbamoyl phosphate + L-ornithine --> H+ + L-citrulline + phosphate (according to UniProt)
  • Protein family

  • ATCase/OTCase family (with [protein|B83462A50FDDD20FE9BD4681824E30AAD10F506B|PyrB], according to UniProt)
  • Structure

  • [PDB|2EF0] (from ''Thermus thermophilus hb8'', 48% identity, 63% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]-[gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]-[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]-[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]-[gene|4202EAE5D0B2A718382092423DD99E35FDE81218|carA]-[gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]-[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]
    description
    [Pubmed|7511775]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, [Pubmed|1312212], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]) [Pubmed|1312212]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • 1A605 ( ''argF''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A605&Search=1A605 BGSC]
  • 1A606 ( ''argF''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A606&Search=1A606 BGSC]
  • BKE11250 ([gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCCGTATAAACTGGTTT, downstream forward: _UP4_TGAGCCAAACTCAGCAGTTT
  • BKK11250 ([gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCCGTATAAACTGGTTT, downstream forward: _UP4_TGAGCCAAACTCAGCAGTTT
  • Expression vector

  • pGP2841: IPTG inducible expression, purification in ''E. coli'' with C-terminal Strep-tag, in [SW|pGP574], available in [SW|Jörg Stülke]'s lab
  • References

  • 6096675,24843172,12107147,1312212,7511775