SubtiBank SubtiBank
yidC2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yidC2

Sec-independent membrane protein translocase, required for development of genetic competence
locus
BSU_23890
pI
9.90
mw
30.60 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
function
membrane insertion of proteins and protein secretion
product
Sec-independent membrane protein translocase
essential
no
synonyms
yqjG,oxaAB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,483,904 2,484,731

    The protein

    Protein family

  • OXA1/ALB3/YidC family (with [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|SpoIIIJ], according to UniProt) [Pubmed|20800571,21194367,15802250]
  • Paralogous protein(s)

  • [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|SpoIIIJ]:
  • Structure

  • [PDB|3WO6] (from ''Bacillus halodurans'', 41% identity) [Pubmed|24739968]
  • [SW|Localization]

  • membrane [Pubmed|22864117]
  • Expression and Regulation

    Operons

    genes
    [gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]-[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM]: attenuation, an mRNA hairpin of the yqjG transcript unfold upon translation arrest of [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM] at decreased [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|SpoIIIJ] levels, in [regulon|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM regulon]
  • regulation

  • repressed by large amounts of [SW|SpoIIIJ], induced by small amounts of [SW|SpoIIIJ] ([protein|search|MifM]) [Pubmed|19779460]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|mifM]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C389 (yqjG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2387 NBRP B. subtilis, Japan]
  • BKE23890 ([gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCTCCTCCTTT, downstream forward: _UP4_TAAAAAAGCAACCCCGTGCA
  • BKK23890 ([gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCTCCTCCTTT, downstream forward: _UP4_TAAAAAAGCAACCCCGTGCA
  • References

    Reviews

  • 22688815,20800571,21194367,15802250,25947384,27879020
  • Original publications

  • 17114254,15995216,11889108,12586834,19717609,19779460,21204254,22383849,22864117,24443530,25313395,25359772,25855636,25903689,26023232,24739968,26331454