SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Sec-independent membrane protein translocase, required for development of genetic competence
30.60 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
membrane insertion of proteins and protein secretion
Sec-independent membrane protein translocase
yqjG, oxaAB

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,483,904 2,484,731

    The protein

    Protein family

  • YidC/Oxa1/Alb3 family [Pubmed|20800571,21194367,15802250]
  • Paralogous protein(s)

  • [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|SpoIIIJ]:
  • Structure

  • [PDB|3WO6] (from ''Bacillus halodurans'', 41% identity) [Pubmed|24739968]
  • [SW|Localization]

  • membrane [Pubmed|22864117]
  • Expression and Regulation



    regulatory mechanism

  • [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM]: attenuation, an mRNA hairpin of the yqjG transcript unfold upon translation arrest of [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM] at decreased [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|SpoIIIJ] levels, in [regulon|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM regulon]
  • regulation

  • repressed by large amounts of [SW|SpoIIIJ], induced by small amounts of [SW|SpoIIIJ] ([protein|search|MifM]) [Pubmed|19779460]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|mifM]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-C389 (yqjG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23890 ([gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCTCCTCCTTT, downstream forward: _UP4_TAAAAAAGCAACCCCGTGCA
  • BKK23890 ([gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCTCCTCCTTT, downstream forward: _UP4_TAAAAAAGCAACCCCGTGCA
  • References


  • 22688815,20800571,21194367,15802250,25947384,27879020
  • Original publications

  • 17114254,15995216,11889108,12586834,19717609,19779460,21204254,22383849,22864117,24443530,25313395,25359772,25855636,25903689,26023232,24739968,26331454