SubtiBank SubtiBank
yidC2
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yidC2

Sec-independent membrane protein translocase, required for development of genetic competence
locus
BSU23890
pI
9.90
mw
30.60 kDa
protein length
275 aa Sequence Blast
gene length
825 bp Sequence Blast
function
membrane insertion of proteins and protein secretion
product
Sec-independent membrane protein translocase
essential
no
synonyms
yqjG, oxaAB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,483,904 → 2,484,731

    The protein

    Protein family

  • YidC/Oxa1/Alb3 family [Pubmed|20800571,21194367,15802250]
  • Paralogous protein(s)

  • [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|SpoIIIJ], one of the two proteins has to be present for viability [Pubmed|17114254]
  • Structure

  • [PDB|3WO6] (from ''Bacillus halodurans'', 41% identity) [Pubmed|24739968]
  • [SW|Localization]

  • membrane [Pubmed|22864117]
  • Expression and Regulation

    Operons

    genes
    [gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]-[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM]: attenuation, an mRNA hairpin of the yqjG transcript unfold upon translation arrest of [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM] at decreased [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|SpoIIIJ] levels, in [regulon|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM regulon]
  • regulation

  • repressed by large amounts of [SW|SpoIIIJ], induced by small amounts of [SW|SpoIIIJ] ([protein|search|MifM]) [Pubmed|19779460]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|mifM]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C389 (yqjG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2387 NBRP B. subtilis, Japan]
  • BKE23890 (Δ[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCTCCTCCTTT, downstream forward: _UP4_TAAAAAAGCAACCCCGTGCA
  • BKK23890 (Δ[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCTCCTCCTTT, downstream forward: _UP4_TAAAAAAGCAACCCCGTGCA
  • References

    Reviews

  • 22688815,20800571,21194367,15802250,25947384,27879020
  • Original publications

  • 17114254,15995216,11889108,12586834,19717609,19779460,21204254,22383849,22864117,24443530,25313395,25359772,25855636,25903689,26023232,24739968,26331454