The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIIIE

ATP-dependent dsDNA translocase, resolution of chromosomal dimers after [SW|DNA replication], transports the forespore chromosome across the [SW|sporulation] septum

locus: BSU_16800

pI: 6.76

mw: 86.96 kDa

protein length: 789 aa

gene length: 2370 bp

function: chromosome partition during [SW|sporulation]

product: ATP-dependent dsDNA translocase required for chromosome partition

essential: no

synonyms

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
• [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 1,752,272 1,754,641

The protein

Catalyzed reaction/ biological activity

• transports the forespore chromosome across the [SW|sporulation ]septum [Pubmed|20516200]
• translocates septum-entrapped DNA only when septum closure precedes complete segregation of chromosomes [Pubmed|19818024]
• the two DNA translocases [protein|DF77B46666595E86081C5345C91E08F86DF9FAEE|SftA] and [protein|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|SpoIIIE] synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively [Pubmed|21239579]
• binds DNA sequences named SRS for SpoIIIE recognition sequence, GAGAAGGG [Pubmed|18391964]

Protein family

• FtsK/SpoIIIE/SftA family (with [protein|DF77B46666595E86081C5345C91E08F86DF9FAEE|SftA], according to UniProt)

Paralogous protein(s)

• [protein|DF77B46666595E86081C5345C91E08F86DF9FAEE|SftA]

[SW|Domains]

• N-terminal transmembrane domain (4 helices) [Pubmed|24297254]
• 134 aa linker [Pubmed|24297254]
• 512 aa motor domain at the C-terminus [Pubmed|24297254]
• [SW|FtsK domain] (aa 450-646) (according to UniProt)

Structure

• [PDB|2IUT] (FtsK from ''Pseudomonas aeruginosa'', partial, 48% identity, complex with [protein|DF77B46666595E86081C5345C91E08F86DF9FAEE|SftA]) [Pubmed|16916635]

[SW|Localization]

• free diffusion in the membrane, no enrichment at septa [pubmed|29439991]
• transmembrane domain mediates dynamic localization to active division sites [Pubmed|20516200]
• complexes are recruited to nascent sites of septation, and are subsequently escorted by the constriction machinery to the center of [SW|sporulation] and division septa [Pubmed|23667326]

Expression and Regulation

Operons

• genes: [gene|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|spoIIIE]-[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]
  description: [Pubmed|22383849]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

Biological materials

Mutant

• BKE16800 ([gene|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|spoIIIE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT
• BKK16800 ([gene|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|spoIIIE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT

References

Reviews

• 22047950,22934648,23400100,25460803,32660383

Original publications

• 29439991,18160039,18593879,3129532,2507870,18593879,23559069,9150232,2492502,11062134,9155041,14680637,7797072,7567988,2507870,8160014,9515703,19818024,19788545,20298190,20516200,21239579,18391964,23667326,11134515,24297254,24769697,25950186,26452092,16916635,26849443,27886417,27891124,29425492,29504934,29588476,32778559