SubtiBank SubtiBank
spoIIIE
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

spoIIIE

ATP-dependent dsDNA translocase, resolution of chromosomal dimers after DNA replication, transports the forespore chromosome across the sporulation septum
locus
BSU16800
pI
6.76
mw
86.96 kDa
protein length
787 aa Sequence Blast
gene length
2361 bp Sequence Blast
function
chromosome partition during sporulation
product
ATP-dependent dsDNA translocase required for chromosome partition
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,752,272 → 1,754,641

    The protein

    Catalyzed reaction/ biological activity

  • transports the forespore chromosome across the sporulation septum [Pubmed|20516200]
  • translocates septum-entrapped DNA only when septum closure precedes complete segregation of chromosomes [Pubmed|19818024]
  • the two DNA translocases [protein|DF77B46666595E86081C5345C91E08F86DF9FAEE|SftA] and [protein|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|SpoIIIE] synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively [Pubmed|21239579]
  • binds DNA sequences named SRS for SpoIIIE recognition sequence, GAGAAGGG [Pubmed|18391964]
  • Paralogous protein(s)

  • [protein|DF77B46666595E86081C5345C91E08F86DF9FAEE|SftA]
  • [SW|Domains]

  • N-terminal transmembrane domain (4 helices) [Pubmed|24297254]
  • 134 aa linker [Pubmed|24297254]
  • 512 aa motor domain at the C-terminus [Pubmed|24297254]
  • Structure

  • [PDB|2IUT] (FtsK from ''Pseudomonas aeruginosa'', partial, 48% identity, complex with [protein|DF77B46666595E86081C5345C91E08F86DF9FAEE|SftA]) [Pubmed|16916635]
  • [SW|Localization]

  • transmembrane domain mediates dynamic localization to active division sites [Pubmed|20516200]
  • complexes are recruited to nascent sites of septation, and are subsequently escorted by the constriction machinery to the center of [SW|sporulation] and division septa [Pubmed|23667326]
  • Expression and Regulation

    Operons

    genes
    [gene|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|spoIIIE]
    description
    [Pubmed|3129532]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE16800 (Δ[gene|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|spoIIIE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT
  • BKK16800 (Δ[gene|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|spoIIIE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT
  • References

    Reviews

  • 22047950,22934648,23400100,25460803
  • Original publications

  • 18160039,18593879,3129532,2507870,18593879,23559069,9150232,2492502,11062134,9155041,14680637,7797072,7567988,2507870,8160014,9515703,19818024,19788545,20298190,20516200,21239579,18391964,23667326,11134515,24297254,24769697,25950186,26452092,16916635,26849443,27886417,27891124