SubtiBank SubtiBank
murR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

murR

transcriptional repressor of genes required for the utilization of N-acetylmuramic acid
locus
BSU_01690
pI
6.87
mw
30.56 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
function
regulation of muramic acid utilization
product
transcriptional repressor
essential
no
synonyms
ybbH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    191,183 192,034

    The protein

    [SW|Domains]

  • HTH rpiR-type domain (aa 3-79) (according to UniProt)
  • [SW|SIS domain] (aa 123-264) (according to UniProt)
  • Structure

  • [PDB|2O3F] (N-terminal domain)
  • Expression and Regulation

    Operons

    genes
    [gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]-[gene|125872506C400CB6B3DAEA8B5130B064DFBA4494|murR]-[gene|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]-[gene|DEACFD435DB01C4B3ADEF397BEE08E2E7C7FCC36|amiE]-[gene|A5D4BF262BD365DCEBA9358C8DB295E605DE4D84|nagZ]-[gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|ybbC]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR]: repression, [pubmed|30038046], in [regulon|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR regulon]
  • regulation

  • expressed in late exponential and early stationary phase [Pubmed|20400549]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B951 (ybbH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1950 NBRP B. subtilis, Japan]
  • BKE01690 ([gene|125872506C400CB6B3DAEA8B5130B064DFBA4494|murR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGGCCATTCTAGTTCTCT, downstream forward: _UP4_TAAGGCATCTTGAAGGGGAG
  • BKK01690 ([gene|125872506C400CB6B3DAEA8B5130B064DFBA4494|murR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGGCCATTCTAGTTCTCT, downstream forward: _UP4_TAAGGCATCTTGAAGGGGAG
  • References

  • 15060041,20400549,10627040,22383849,30038046