SubtiBank SubtiBank
amj
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

amj

lipid II flippase, alternative to [protein|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|MurJ]
locus
BSU_04230
pI
10.60
mw
29.30 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
function
export of lipid II
product
lipid II flippase
essential
no
synonyms
ydaH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    474,731 475,540

    Phenotypes of a mutant

  • an ''[gene|12DB5AF311932991B66716BBCD08DA2C45B43BB9|amj] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable [Pubmed|25918422]
  • The protein

    Protein family

  • Amj family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|12DB5AF311932991B66716BBCD08DA2C45B43BB9|amj]
    description
    [Pubmed|17434969]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • induced in the stationary phase due to the internal production of toxic peptides ([SW|SdpC], [SW|SkfA]) [Pubmed|26364265]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C089 (ydaH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2087 NBRP B. subtilis, Japan]
  • BKE04230 ([gene|12DB5AF311932991B66716BBCD08DA2C45B43BB9|amj]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTATTCTTCCTCCAAT, downstream forward: _UP4_TAATAAGAAAGGCTGGATCA
  • BKK04230 ([gene|12DB5AF311932991B66716BBCD08DA2C45B43BB9|amj]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTATTCTTCCTCCAAT, downstream forward: _UP4_TAATAAGAAAGGCTGGATCA
  • References

    Reviews

  • 26679002,28975672
  • Original Publications

  • 17434969,25918422,17434969,26364265