SubtiBank SubtiBank
moaE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

moaE

molybdopterin synthase (large subunit), catalyses the transfer of sulfide from MoaD thiocarboxylate
locus
BSU_14300
pI
4.75
mw
17.64 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
nitrate respiration
product
molybdopterin synthase (large subunit)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.10|Biosynthesis of molybdopterin]
  • Gene

    Coordinates
    1,498,966 1,499,439

    The protein

    Catalyzed reaction/ biological activity

  • catalyses the transfer of sulfide from [protein|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|MoaD] thiocarboxylate
  • 2 [molybdopterin-synthase sulfur-carrier protein]-C-terminal Gly-NH-CH2-C(O)SH + cyclic pyranopterin phosphate + H2O --> 2 [molybdopterin-synthase sulfur-carrier protein]-C-terminal Gly-Gly + 4 H+ + molybdopterin (according to UniProt)
  • Protein family

  • moaE family (single member, according to UniProt)
  • Structure

  • [PDB|1NVI] (the [protein|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|MoaD]-[protein|12F27FA4DB8232B52271565C4F4937520A4F5C7B|MoaE] complex from ''E. coli'') [Pubmed|12571227]
  • Expression and Regulation

    Operons

    genes
    [gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]-[gene|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|moeB]-[gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]-[gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]-[gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]-[gene|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|moaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14300 ([gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGTAATCTCAAACCGTT, downstream forward: _UP4_CCAGACCTAAGCGAGGGAGA
  • BKK14300 ([gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGTAATCTCAAACCGTT, downstream forward: _UP4_CCAGACCTAAGCGAGGGAGA
  • References

    Reviews

  • 22616866,23539623
  • Original publications

  • 12571227,22383849