SubtiBank SubtiBank
nadC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nadC

nicotinate-nucleotide diphosphorylase (carboxylating)
locus
BSU_27860
pI
5.18
mw
31.24 kDa
protein length
289 aa Sequence Blast
gene length
870 bp Sequence Blast
function
NAD biosynthesis
product
nicotinate-nucleotide diphosphorylase (carboxylating)
essential
no
ec
2.4.2.19
synonyms
yrxB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.11|Biosynthesis of NAD(P)]
  • Gene

    Coordinates
    2,847,048 2,847,917

    The protein

    Catalyzed reaction/ biological activity

  • CO2 + diphosphate + nicotinate β-D-ribonucleotide --> 5-phospho-α-D-ribose 1-diphosphate + 2 H+ + quinolinate (according to UniProt)
  • Protein family

  • nadC/modD family (single member, according to UniProt)
  • Structure

  • [PDB|1X1O] (from Thermus thermophilus, 45% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]-[gene|1368734DCC28C618AA173B865784BDDAEA912623|nadC]-[gene|F92F17578F06EF2292D0923662933463D7C86498|nadA]
    description
    [Pubmed|8444804]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|16199587]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|nadB]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE27860 ([gene|1368734DCC28C618AA173B865784BDDAEA912623|nadC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCAAGAAAAAAGTGATTC, downstream forward: _UP4_TGTTATGTCAATTCTTGATG
  • BKK27860 ([gene|1368734DCC28C618AA173B865784BDDAEA912623|nadC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCAAGAAAAAAGTGATTC, downstream forward: _UP4_TGTTATGTCAATTCTTGATG
  • References

  • 8444804,16199587