SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative toxin
64.12 kDa
protein length
571 aa Sequence Blast
gene length
1716 bp Sequence Blast
putative toxin

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,275,706 2,277,421

    The protein


  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE21580 ([gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCTCCTTTCAAG, downstream forward: _UP4_AACTTTAGAAAGTAGGTGCG
  • BKK21580 ([gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCTCCTTTCAAG, downstream forward: _UP4_AACTTTAGAAAGTAGGTGCG
  • References

  • 22200572,20817675