SubtiBank SubtiBank
yodT

yodT

similar to adenosylmethionine-8-amino-7-oxononanoate aminotransferase
locus
BSU_19740
pI
5.96
mw
48.25 kDa
protein length
444 aa Sequence Blast
gene length
1332 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,144,356 → 2,145,690

    The protein

    Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|YhxA]:
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3I4J] (from Deinococcus Radiodurans 39% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]-[gene|D8A050BF150C6E5B910C24C0E023F0829EC95BAD|yodS]-[gene|138832210AC94B17E081F3D0AF9BCFE3BE63E601|yodR]-[gene|161ADC907D4902001C8751F51CFA762828C26110|yodQ]-[gene|39749B5EADC3C056BAF232E0B586C65B989F7F77|yodP]-[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]-[gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]-[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]
    description
    [Pubmed|22383849,14523133]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|14523133], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporuation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|14523133]
  • view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B508 (yodT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1507 NBRP B. subtilis, Japan]
  • BKE19740 (Δ[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCCCACCTCAAAACC, downstream forward: _UP4_AACTTAAAAAAGGATTGACA
  • BKK19740 (Δ[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCCCACCTCAAAACC, downstream forward: _UP4_AACTTAAAAAAGGATTGACA
  • References

  • 14523133