SubtiBank SubtiBank
pksJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pksJ

polyketide synthase
locus
BSU_17180
pI
5.00
mw
562.00 kDa
protein length
5043 aa Sequence Blast
gene length
15132 bp Sequence Blast
function
polyketide synthesis
product
polyketide synthase
essential
no
synonyms
pksK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    1,792,806 1,807,937

    The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • [SW|Domains]

  • 5 [SW|Carrier domain]s (aa 590-667, aa 1654-1729, aa 3114-3188, aa 3212-3286, aa 4459-4536) (according to UniProt)
  • Structure

  • [PDB|4NA1] [Pubmed|24508341]
  • Expression and Regulation

    Operons

    genes
    [gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|24187085], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|24187085], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
  • additional information

  • this is a very large operon comprising about 75 kb
  • view in new tab

    genes
    [gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE17180 ([gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTGCCTCCATTTC, downstream forward: _UP4_ACTGCGGCAAACATATGGGA
  • BKK17180 ([gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTGCCTCCATTTC, downstream forward: _UP4_ACTGCGGCAAACATATGGGA
  • References

  • 17190806,22383849,24187085,24508341