SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


22.77 kDa
protein length
212 aa Sequence Blast
gene length
639 bp Sequence Blast
pentose phosphate pathway

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Pentose phosphate pathway]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,807,754 3,808,392

    The protein

    Catalyzed reaction/ biological activity

  • D-glyceraldehyde 3-phosphate + D-sedoheptulose 7-phosphate --> β-D-fructose 6-phosphate + D-erythrose 4-phosphate (according to UniProt)
  • Protein family

  • transaldolase family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser-39 [Pubmed|17218307,16493705,17726680], ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] [Pubmed|20389117]
  • Structure

  • [PDB|3R8R] [Pubmed|22212631]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation




  • constitutively expressed [Pubmed|11489127]
  • view in new tab

    Biological materials


  • MGNA-B264 (ywjH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37110 ([gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCAAAAAGCCTCCCT, downstream forward: _UP4_TAATGAAAGGGGCGGCAAAC
  • BKK37110 ([gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCAAAAAGCCTCCCT, downstream forward: _UP4_TAATGAAAGGGGCGGCAAAC
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP819, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • pGP1790 (expression of ''[gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]'' in ''B. subtilis'', in [SW|pGP1389]), available in [SW|Jörg Stülke]'s lab
  • GP1409 (''ywjH''-''Strep'' ''(spc)'') & GP1411 (''ywjH''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1407 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 25267444
  • Original publications

  • 17726680,17218307,16493705,11489127,20389117,21857661,22212631,15378759