SubtiBank SubtiBank
ywjH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywjH

transaldolase
locus
BSU37110
pI
5.88
mw
22.77 kDa
protein length
212 aa Sequence Blast
gene length
639 bp Sequence Blast
function
pentose phosphate pathway
product
transaldolase
essential
no
ec
2.2.1.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.3|Pentose phosphate pathway]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,807,754 3,808,392

    The protein

    Catalyzed reaction/ biological activity

  • Sedoheptulose 7-phosphate + D-glyceraldehyde 3-phosphate = D-erythrose 4-phosphate + D-fructose 6-phosphate (according to Swiss-Prot)
  • Protein family

  • Type 3B subfamily (according to Swiss-Prot)
  • Modification

  • phosphorylation on Ser-39 [Pubmed|17218307,16493705,17726680], ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] [Pubmed|20389117]
  • Structure

  • [PDB|3R8R] [Pubmed|22212631]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]-[gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]
    description
    [Pubmed|11489127]

    regulation

  • constitutively expressed [Pubmed|11489127]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B264 (ywjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1263 NBRP B. subtilis, Japan]
  • BKE37110 ([gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCAAAAAGCCTCCCT, downstream forward: _UP4_TAATGAAAGGGGCGGCAAAC
  • BKK37110 ([gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCAAAAAGCCTCCCT, downstream forward: _UP4_TAATGAAAGGGGCGGCAAAC
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP819, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • pGP1790 (expression of ''[gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]'' in ''B. subtilis'', in [SW|pGP1389]), available in [SW|Jörg Stülke]'s lab
  • GP1409 (''ywjH''-''Strep'' ''(spc)'') & GP1411 (''ywjH''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1407 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 25267444
  • Original publications

  • 17726680,17218307,16493705,11489127,20389117,21857661,22212631,15378759