SubtiBank SubtiBank
yxaH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yxaH

putative transporter
locus
BSU_39970
pI
9.95
mw
46.04 kDa
protein length
402 aa Sequence Blast
gene length
1209 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,104,929 4,106,137

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]: repression, [Pubmed|15317768], in [regulon|52D560AA02F0849CB24460A496021560063B2E12|LmrA regulon]
  • [protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR]: repression, [Pubmed|17483215], in [regulon|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR regulon]
  • regulation

  • induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
  • additional information

  • major regulator: [protein|search|QdoR] [PubMed|17483215]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B685 (yxaH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1684 NBRP B. subtilis, Japan]
  • BKE39970 ([gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCATCACGCTCCTTT, downstream forward: _UP4_TAGATGCCTATTGGCGTCTA
  • BKK39970 ([gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCATCACGCTCCTTT, downstream forward: _UP4_TAGATGCCTATTGGCGTCTA
  • References

  • 10746760,15317768,17483215