SubtiBank SubtiBank
ywcE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywcE

holin, required for spore morphogenesis and germination
locus
BSU_38130
pI
9.85
mw
9.82 kDa
protein length
gene length
264 bp Sequence Blast
function
required for spore morphogenesis and germination
product
holin
essential
no
synonyms
ipa-41r

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,914,009 3,914,272

    Phenotypes of a mutant

  • forms spores with a reduced outer coat [pubmed|16159778]
  • The protein

    Protein family

  • ywcE family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [pubmed|16159778]
  • spore core membran [pubmed|16159778]
  • spore outer membran [pubmed|16159778]
  • Expression and Regulation

    Operons

    genes
    [gene|1426D5E85EA17234A3E2C98018DA99437F8E712C|ywcE]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16159778], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|16159778], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: repression, [pubmed|28439033], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • repressed during the log phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]), expressed only at the onset of stationary phase [Pubmed|16159778]
  • repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [pubmed|28439033]
  • view in new tab

    Biological materials

    Mutant

  • BKE38130 ([gene|1426D5E85EA17234A3E2C98018DA99437F8E712C|ywcE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTCTCCTTTCATT, downstream forward: _UP4_TGAAGACAGCAAAAAACCCT
  • BKK38130 ([gene|1426D5E85EA17234A3E2C98018DA99437F8E712C|ywcE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTCTCCTTTCATT, downstream forward: _UP4_TGAAGACAGCAAAAAACCCT
  • labs

  • [SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
  • References

  • 16159778,9353933,23033921,28439033