The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywcE

holin, required for spore morphogenesis and germination

locus: BSU_38130

pI: 9.85

mw: 9.82 kDa

protein length: 87 aa

gene length: 264 bp

function: required for spore morphogenesis and germination

product: holin

essential: no

synonyms: ipa-41r

Genomic Context

categories

• [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
• [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 3,914,009 3,914,272

Phenotypes of a mutant

• forms spores with a reduced outer coat [pubmed|16159778]

The protein

Protein family

• ywcE family (single member, according to UniProt)

[SW|Localization]

• cell membrane [pubmed|16159778]
• spore core membran [pubmed|16159778]
• spore outer membran [pubmed|16159778]

Expression and Regulation

Operons

• genes: [gene|1426D5E85EA17234A3E2C98018DA99437F8E712C|ywcE]
  description: [Pubmed|9353933]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16159778], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|16159778], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: repression, [pubmed|28439033], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]

  regulation

  • repressed during the log phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]), expressed only at the onset of stationary phase [Pubmed|16159778]
  • repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [pubmed|28439033]

Biological materials

Mutant

• BKE38130 ([gene|1426D5E85EA17234A3E2C98018DA99437F8E712C|ywcE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTCTCCTTTCATT, downstream forward: _UP4_TGAAGACAGCAAAAAACCCT
• BKK38130 ([gene|1426D5E85EA17234A3E2C98018DA99437F8E712C|ywcE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTCTCCTTTCATT, downstream forward: _UP4_TGAAGACAGCAAAAAACCCT

labs

• [SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]

References

• 16159778,9353933,23033921,28439033