SubtiBank SubtiBank
yceB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yceB

similar to monooxygenase
locus
BSU_02880
pI
6.50
mw
34.86 kDa
protein length
331 aa Sequence Blast
gene length
996 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    310,880 311,875

    The protein

    Protein family

  • Flavin-utilizing monoxygenases
  • Paralogous protein(s)

  • [protein|A1DCFF8D225C87197104742E72A0D4F238BC30EB|YwcH]
  • [protein|40654E556CC97A4E47FC757F93F29BEACD21CC3A|YddN]:
  • [protein|A36E7D50E2EBD0F0109491FF2CAD2CA84372B2CF|YvbT]:
  • [protein|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|CmoO]:
  • Structure

  • [PDB|4US5] (from Streptomyces bottropensis, 39% identity) [pubmed|24554499]
  • Expression and Regulation

    Operons

    genes
    [gene|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|yceB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B983 (yceB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1982 NBRP B. subtilis, Japan]
  • BKE02880 ([gene|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|yceB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGGCCGCTTCCTTTCT, downstream forward: _UP4_TAAAAAAAGCAGTTTTCCCT
  • BKK02880 ([gene|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|yceB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGGCCGCTTCCTTTCT, downstream forward: _UP4_TAAAAAAAGCAGTTTTCCCT
  • References

    Research papers

  • 24554499