SubtiBank SubtiBank
lrpB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lrpB

transcriptional regulator ([SW|Lrp family]) involved in repression of [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA] transcription and [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]-dependent [SW|sporulation]
locus
BSU_05060
pI
6.68
mw
17.18 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
function
repression of [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA] transcription and [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]-dependent [SW|sporulation]
product
transcription regulator ([SW|Lrp family])
essential
no
synonyms
yddP

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    Coordinates
    552,052 552,501

    The protein

    Protein family

  • ([SW|Lrp family])
  • Structure

  • [PDB|2CFX] ([protein|AC2618C53DA020F2CD5192AEE462D15E8EE0F57F|LrpC], 31% identity) [pubmed|16528101]
  • Biological materials

    Mutant

  • MGNA-C110 (yczA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2108 NBRP B. subtilis, Japan]
  • BKE05060 ([gene|1437D66EABB5D7FF4F8B9EBAD624510D86F0C8B4|lrpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAACTCCTTTCACAG, downstream forward: _UP4_TAATGCGCTTGTTATTATAA
  • BKK05060 ([gene|1437D66EABB5D7FF4F8B9EBAD624510D86F0C8B4|lrpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAACTCCTTTCACAG, downstream forward: _UP4_TAATGCGCTTGTTATTATAA
  • References

    Research papers

  • 16528101