SubtiBank SubtiBank
recX
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

recX

recombination protein, modulates the SOS response and facilitates [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-mediated recombinational repair and genetic recombination
locus
BSU_08520
pI
6.29
mw
30.86 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
[SW|DNA repair/ recombination]
product
recombination protein
essential
no
synonyms
yfhG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    925,633 926,427

    Phenotypes of a mutant

  • reduced natural transformation with plasmid or chromosomal DNA [Pubmed|23284295]
  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
  • The protein

    Catalyzed reaction/ biological activity

  • modulates the "length or packing" of a [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] filament, thereby [protein|144E7D10740C5F146403612B8A0C88E02FB9C572|RecX] facilitates the initiation of recombination and increases recombination across species [Pubmed|23284295]
  • inhibits [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-catalyzed ATP hydrolysis [pubmed|28911099]
  • inhibits stable [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] nucleation and polymerization on ssDNA [pubmed|28911099]
  • induces [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] nucleoprotein filament depolymerization [pubmed|28911099]
  • promotes a net [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] disassembly from viral ssDNAs not homologous to the host genome [pubmed|31876108]
  • Protein family

  • recX family (single member, according to UniProt)
  • Structure

  • [PDB|3D5L] (from Lactobacillus reuterii, 36% identity)
  • [SW|Localization]

  • forms foci on the nucleoid upon DNA damage [Pubmed|23284295]
  • forms foci at the cells poles and/ or the nucleoid upon induction of genetic competence [Pubmed|23284295]
  • Expression and Regulation

    Operons

    genes
    [gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]-[gene|CEB1A0835C26E14E04BA99F933787C4550A96388|yfhH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP3533 (Δ[gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]::kan), available in [SW|Jörg Stülke]'s lab
  • MGNA-C361 (yfhG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2359 NBRP B. subtilis, Japan]
  • BKE08520 ([gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA, downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA
  • BKK08520 ([gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08520 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA, downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA
  • References

  • 23284295,22383849,24285298,24285298,28911099,30050509,31876108