SubtiBank SubtiBank
yhfQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhfQ

iron/ citrate [SW|ABC transporter] (solute-binding protein)
locus
BSU_10330
pI
9.30
mw
38.39 kDa
protein length
323 aa Sequence Blast
gene length
972 bp Sequence Blast
function
iron uptake
product
iron/ citrate [SW|ABC transporter] (solute-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,107,733 1,108,704

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 8 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|569510093E5B69A0368205920A21A81CADF030E9|FecC]
  • Structure

  • [PDB|3EIW] (from ''Staphylococcus aureus'', the [protein|569510093E5B69A0368205920A21A81CADF030E9|FecC]-[protein|1469148C83B1704E721652203EA31F0E2C33FDC6|YhfQ] complex, 39% identity) [Pubmed|19400778]
  • [SW|Localization]

  • associated to the membrane (via [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|FecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|FecE]) [Pubmed|10092453,18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|DCA3A7605CA19FAF61BDB75421BD41F11CB638E5|yhfO]-[gene|FE034FDCEAD4F4E91FD0147E16685632069E3316|yhfP]-[gene|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|FE034FDCEAD4F4E91FD0147E16685632069E3316|yhfP]-[gene|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B278 (yhfQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1277 NBRP B. subtilis, Japan]
  • BKE10330 ([gene|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCCAGTCTCTCCT, downstream forward: _UP4_TAAAAGAAAAGACAGGCAAA
  • BKK10330 ([gene|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCCAGTCTCTCCT, downstream forward: _UP4_TAAAAGAAAAGACAGGCAAA
  • References

  • 10092453,12354229,18763711,19400778