SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor ([SW|Xre family]) of the [gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]-[gene|search|ansB ]operon
13.09 kDa
protein length
116 aa Sequence Blast
gene length
351 bp Sequence Blast
negative regulation of the [gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]-[gene|search|ansB ]operon
transcriptional regulator ([SW|Xre family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of asparagine/ aspartate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,456,990 2,457,340

    Phenotypes of a mutant

  • the [gene|search|ansR ]mutation allows glutamate utilization of a ''[gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]'' mutant [Pubmed|21219666]
  • The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 6-60) (according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|146947C974D62BCB282BA3F5B924B35695D75886|AnsR]: negative autoregulation, undefined, in [regulon|146947C974D62BCB282BA3F5B924B35695D75886|AnsR regulon]
  • regulation

  • induced in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab

    Biological materials


  • GP1152 (del tet) available in [SW|Jörg Stülke]'s lab
  • BKE23590 ([gene|146947C974D62BCB282BA3F5B924B35695D75886|ansR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACTTCCGCTCCTTTT, downstream forward: _UP4_GAGGAACTGAGTTAATCTTT
  • BKK23590 ([gene|146947C974D62BCB282BA3F5B924B35695D75886|ansR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACTTCCGCTCCTTTT, downstream forward: _UP4_GAGGAACTGAGTTAATCTTT
  • Expression vectors

  • expression of native ''ansR'' in ''B. subtilis'': pGP873 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • References

  • 8478318,11914346,21219666