SubtiBank SubtiBank
fbpB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

fbpB

[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]-regulated basic protein, acts as RNA chaperone for [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA], response to iron limitation
locus
BSU_04530
pI
10.73
mw
6.88 kDa
protein length
gene length
180 bp Sequence Blast
function
RNA chaperone
product
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]-regulated basic protein, acts as RNA chaperone for [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA], response to iron limitation
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.2|RNA chaperones]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    Coordinates
    506,322 506,501

    Phenotypes of a mutant

  • transcription profile of a ''[gene|35ABF185A1AD60E21ECF32AF9D01123307B5152D|fbpA] [gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]'' double mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE27416 GEO] [Pubmed|22389480]
  • Expression and Regulation

    Operons

    genes
    [gene|35ABF185A1AD60E21ECF32AF9D01123307B5152D|fbpA]-[gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]
    description
    [pubmed|18697947]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by iron starvation (third wave, under extreme starvation, iron sparing response) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|29133393,12354229]
  • view in new tab

    Biological materials

    Mutant

  • BKE04530 ([gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTAACTCCGTCAGC, downstream forward: _UP4_TAAAAAGAGCCGGTAAGGCT
  • BKK04530 ([gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTAACTCCGTCAGC, downstream forward: _UP4_TAAAAAGAGCCGGTAAGGCT
  • References

  • 12354229,18697947,20525796,22389480,22427629,29133393